View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20222_high_22 (Length: 297)
Name: NF20222_high_22
Description: NF20222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20222_high_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 56 - 285
Target Start/End: Original strand, 4313216 - 4313445
Alignment:
| Q |
56 |
gcccctaccacgttggtttcataatttcattctttcatcactttcctttaacgcacttccatgtagatggtacgtacagaggacgatgtgtatctggcta |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4313216 |
gcccctaccacgttggtttcataatttcattctttcatcactttcctttaacgcacttccatgtagatggtacgtacagaggacgatgtgtatctggcta |
4313315 |
T |
|
| Q |
156 |
atggctgaccataaaaatttactattaatttcataatttcactgaaatccatgcaagttaattcttcactacttcccaccaatttgggtccttggccacg |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4313316 |
atggctgaccataaaaatttactattaatttcataatttcactgaaatccatgcaagttaattcttcactacttcccaccaatttgggtccttggccacg |
4313415 |
T |
|
| Q |
256 |
atgcacaaaacaaagaatttcattgggcct |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4313416 |
atgcacaaaacaaagaatttcattgggcct |
4313445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University