View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20222_high_33 (Length: 212)
Name: NF20222_high_33
Description: NF20222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20222_high_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 15 - 194
Target Start/End: Complemental strand, 32704059 - 32703880
Alignment:
| Q |
15 |
aatataattccagtaagagttcccttgcaaaatgtcaccaacctgttgaaacaaaacaaacaactgaagtgtaagactgaactttcaggctggcatgact |
114 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32704059 |
aatataattctagtaagagttcccttgcaaaatgtcaccaacctgatgaaacaaaacaaacaactgatgtgtaagactgaactttcaggctggcatgact |
32703960 |
T |
|
| Q |
115 |
gcagctcatggaattcttggagagtgttgtacccttaagaccaaccctaaacacatggtaccttcttggaaagaacttgg |
194 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32703959 |
gcagctcatggaattcttggagactgttgtacccttaagaccaaccctaaacacatggtaccttcttggaaagaacttgg |
32703880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University