View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20222_low_19 (Length: 330)
Name: NF20222_low_19
Description: NF20222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20222_low_19 |
 | |
|
| [»] scaffold2125 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 84 - 280
Target Start/End: Complemental strand, 2506249 - 2506053
Alignment:
| Q |
84 |
agggatatgaaaatatagaacatcactacaaacgtgtaatgatttaatgttgacctgtctgggaacaaagcttaaggatggcgcagttgttgtgctcatg |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2506249 |
agggatatgaaaatatagaacatcactacaaacgtgtaatgatttaatgttgacctgtctgggaacaaagcttaaggatggcgcagttgttgtgcccatg |
2506150 |
T |
|
| Q |
184 |
ctacaacaaaccaatgtagtggatgaggaacttcggttcggttgaggattgctctgcgatggttgaccacggtaccatacaagatgaatgaacttgt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2506149 |
ctacaacaaaccaatgtagtggatgaggaacttcggttcggttgaggattgctctgcgatggttgaccacggtaccatacaagatgaatgaacttgt |
2506053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 89 - 134
Target Start/End: Complemental strand, 9507425 - 9507380
Alignment:
| Q |
89 |
tatgaaaatatagaacatcactacaaacgtgtaatgatttaatgtt |
134 |
Q |
| |
|
||||||||||| |||||| ||||||||| ||||||||| ||||||| |
|
|
| T |
9507425 |
tatgaaaatatcgaacattactacaaacttgtaatgatctaatgtt |
9507380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 89 - 134
Target Start/End: Complemental strand, 9515400 - 9515355
Alignment:
| Q |
89 |
tatgaaaatatagaacatcactacaaacgtgtaatgatttaatgtt |
134 |
Q |
| |
|
||||||||||| |||||| ||||||||| ||||||||| ||||||| |
|
|
| T |
9515400 |
tatgaaaatatcgaacattactacaaacttgtaatgatctaatgtt |
9515355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2125 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold2125
Description:
Target: scaffold2125; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 84 - 136
Target Start/End: Original strand, 999 - 1051
Alignment:
| Q |
84 |
agggatatgaaaatatagaacatcactacaaacgtgtaatgatttaatgttga |
136 |
Q |
| |
|
||||||||||| ||||||||||||| |||||| ||||||||| |||| |||| |
|
|
| T |
999 |
agggatatgaacatatagaacatcattacaaaattgtaatgatctaatattga |
1051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University