View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20222_low_20 (Length: 323)
Name: NF20222_low_20
Description: NF20222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20222_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 17 - 309
Target Start/End: Complemental strand, 10560303 - 10560011
Alignment:
| Q |
17 |
aacctctgtctctgagatgtagggacctttataggtggtgtgaagagtgattttagccctccgcatcaccctttctttagatctcgcggtgtatcaagta |
116 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10560303 |
aacctttgtctctgagatgtagggacctctataggtggtgtgaagagtggttttagccctctgcatcaccctttctttagatctcgcggtgtatcaagca |
10560204 |
T |
 |
| Q |
117 |
ccagtatatttggattatgtagaaataacacaatcgggacggtcaaatgcttaacaacggtggttgtttacaacacatgttttgcgtgacgattcaaagt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10560203 |
ccagtatatttggattatgtagaaataacacaatcgtgacggtcaaatgcttaacagcggtggttgtttacaacacatgttttgcgtgacgattcaaagt |
10560104 |
T |
 |
| Q |
217 |
tgtttgtgtttgtagttcctcttaaaggtgatccaatgctatagagggaaaaatttgtagttgattatgttgaaaaacctgtgagggtctgtg |
309 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10560103 |
tgtttgtgtttgtagttccccttaaaggtgatccaatgctatagagggaaaaatttgtagttgattatgttgaaaaacttgtgagggtctgtg |
10560011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University