View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20222_low_24 (Length: 305)
Name: NF20222_low_24
Description: NF20222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20222_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 12 - 289
Target Start/End: Original strand, 33914507 - 33914784
Alignment:
| Q |
12 |
atgattttaggtctcaaaatggagagaccaggaacgtacaagcattattctttatttagattgagtaaaaatttaattcctatttgaatgtctatcctat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33914507 |
atgattttaggtctcaaaatggagagaccaggaacgtacaagcattattctttatttagattgagtaaaaatttaattcctatttgaatgtctatcctat |
33914606 |
T |
|
| Q |
112 |
ttgtagtgaattttgagctttggcctgcaagtatatagcaaaaggttaatatactaacagaatcttttaaaacttacacttgtgtcttttagattggttc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33914607 |
ttgtagtgaattttgagctttggcctgcaagtatatagcaaaaggttaatatactaacagaatcttttaaaacttacacttgtgtcttttagattggttc |
33914706 |
T |
|
| Q |
212 |
cacagtatgatccttttcatgattttaagaatttgtcactctttttctgtcattactggctctgtggcccatatgctt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33914707 |
cacagtatgatccttttcatgattttaagaatttgtcactctttttctgtcattactggctctgtggcccatatgctt |
33914784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University