View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20222_low_36 (Length: 229)

Name: NF20222_low_36
Description: NF20222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20222_low_36
NF20222_low_36
[»] chr2 (1 HSPs)
chr2 (14-214)||(11296902-11297101)


Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 14 - 214
Target Start/End: Original strand, 11296902 - 11297101
Alignment:
14 cacagactacaccacaacacatgagatcttatactctatacaaaatgaacaacatattattgaagaaaataatgaaaacaaacaattggatgtgttcaac 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11296902 cacagactacaccacaacacatgagatcttatactctatacaaaatgaacaacatattattgaagaaaataatgaaaacaaacaattggatgtgttcaac 11297001  T
114 tcaaaaactacttagtgatgaacatgatcaaaacaacaaaacttaaaagatggaattgggatccctttcacatgccttggaccagaaatttgcatagata 213  Q
    |||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||    
11297002 tcaaaaactacttagtaatg-acatgatcaaaacaacaaaacttaaaagatggaattgggatccctatcacacgccttggaccagaaatttgcatagata 11297100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University