View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20223_high_4 (Length: 269)
Name: NF20223_high_4
Description: NF20223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20223_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 10 - 252
Target Start/End: Original strand, 42952741 - 42952983
Alignment:
| Q |
10 |
aagaatatcggcattattacataataaattttgttgaaggaacaatagctggttacagnnnnnnnnnnnnnnnnnnnnnnnngttgatttatttattaat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42952741 |
aagaatatcggcattattacataataaattttgttgaaggaacaatagctggttacagaaaaaatgaatttaaaaataaaaagttgatttatttattaat |
42952840 |
T |
|
| Q |
110 |
tgtagtagatgtgaaggttagtctgcgatgagtagatgcatcgtcaggacgcgtctcttcttgaatccgcaataactaagtcaaatccacgtattgctga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42952841 |
tgtagtagatgtgaaggttagtctgcgatgagtagatgcatcgtcaggacgcgtctcttcttgaatccgcaataactaagtcaaatccacgtattgctga |
42952940 |
T |
|
| Q |
210 |
ctcatgcttatcatttttcataattactattaattacattcat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42952941 |
ctcatgcttatcatttttcataattactattaattacattcat |
42952983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University