View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20223_low_5 (Length: 253)
Name: NF20223_low_5
Description: NF20223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20223_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 22340171 - 22340408
Alignment:
| Q |
1 |
gaatgatgaaaaaatagaagcatgtgggaggccctcttgaaacggagacaagagcctcaatttgagacttggaaatttgtatggttatttgttcattttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22340171 |
gaatgatgaaaaaatagaagcatgtgggaggccctcttgaaacggagacaagagcctcaatttgagacttggaaatttgtatggttatttgttcattttc |
22340270 |
T |
|
| Q |
101 |
ccctatagaatgaattcattgaggaccagtcaattgggatttgaacgttgcatgtgccatctctcttctccgcatccaaatttaagagattgatgcaacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22340271 |
ccctatagaatgaattcattgaggaccagtcaattgggatttgaacgttgcatgtgccatctctcttctccgcatccaaatttaagagattgatgcaacc |
22340370 |
T |
|
| Q |
201 |
ctttggattatttggccccactataatcactttgttgg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22340371 |
ctttggattatttggccccactataatcactttgttgg |
22340408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University