View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20223_low_6 (Length: 236)
Name: NF20223_low_6
Description: NF20223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20223_low_6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 2748850 - 2749070
Alignment:
| Q |
16 |
agaaattatgttttggagtttggcccataaatgggaggcgttttggatttttggtataccgaaaaacaatccctggatagttttgctatccggtgatcat |
115 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2748850 |
agaaattctgttttggagtttggcccataaatgggaggcgttttggatttctggtataccgaaaaacaatccccggatagttttgctatccggtgatcat |
2748949 |
T |
 |
| Q |
116 |
tgttttaagtaccttttacggttttttaaacaagatccatatataaattgtaatacccttctcattgctcgagaaaatcagctggctgaagtaccaaaat |
215 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2748950 |
tgttttaagtaccttttactgttttttaaacaagatccatatataaattgtaatacccttctcattgctcgagaaaatcagttggctgaagtaccaaaat |
2749049 |
T |
 |
| Q |
216 |
actttgtggaatggtgaaagt |
236 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
2749050 |
actttgtggaatggtgtaagt |
2749070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University