View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20224_high_8 (Length: 302)
Name: NF20224_high_8
Description: NF20224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20224_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 44 - 288
Target Start/End: Original strand, 35644219 - 35644461
Alignment:
| Q |
44 |
atactcccttcaaagtgtcgtcttaatctcatacgactcttcttccacttggctatcatgatcagatctgctctttgccttgtcggaaccttagttgagg |
143 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||| | ||||||||| ||||||||||| || |
|
|
| T |
35644219 |
atactcccttcaaagtgtcgtcttaatcttatacgactcttcttccatttggctatcatgatcaaatctgct--tcgccttgtcgaaaccttagttgtgg |
35644316 |
T |
|
| Q |
144 |
gtttatgacaaataaaataagtataccgaatcacacaagcaatcaagtagtaagtagatattgtttttacagggattgttgttcgactcaccaattatat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
35644317 |
gtttatgacaaataaaataagtataccgaatcacacaagtaatcaagtagtaagtagatattgtttttacagagattgttgttcgactcgacaattatat |
35644416 |
T |
|
| Q |
244 |
taagcttaattaaaaacaataaatcgggagtttgcataggatttg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35644417 |
taagcttaattaaaaacaataaatcgggagtttgcataggatttg |
35644461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University