View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20224_low_13 (Length: 241)
Name: NF20224_low_13
Description: NF20224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20224_low_13 |
 |  |
|
| [»] chr2 (6 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 11 - 241
Target Start/End: Original strand, 38792100 - 38792330
Alignment:
| Q |
11 |
agaaaatgtgtggagatagatttggatagacgtttgttgttgaatattatgcttttgctgtggtcgatatggacacaagaaaggtaactgtgttgaaaga |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38792100 |
agaatatgtgtggagatagatttggatagacgtttgttgttgaatattatgcttttgctgtggtcgatatggacacaagaaaggtaactgtgttgaaaga |
38792199 |
T |
 |
| Q |
111 |
gttagtgatgtttgagagaaaatgcaggggaagattgaagagattgtcgaggatttagtcgcgaaggaagtagagctatgtttgatggaggacttgattg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38792200 |
gttagtgatgtttgagagaaaatgcaggggaagattgaagagattgtcgaggatttagtcgcgaaggaagtagagctatgtttgatggaggacttgattg |
38792299 |
T |
 |
| Q |
211 |
gagagcgtaggcaagaacttgagaaaaaaga |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38792300 |
gagagcgtaggcaagaacttgagaaaaaaga |
38792330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 127 - 229
Target Start/End: Original strand, 39152012 - 39152114
Alignment:
| Q |
127 |
agaaaatgcaggggaagattgaagagattgtcgaggatttagtcgcgaaggaagtagagctatgtttgatggaggacttgattggagagcgtaggcaaga |
226 |
Q |
| |
|
|||||||||||||||| ||||| || |||| ||||||| || || ||||||| |||| | ||||||||||||||||||||||||||| | |||||| |
|
|
| T |
39152012 |
agaaaatgcaggggaaaattgatgaatgtgtcaaggattttgtagcaaaggaagggcagctctatttgatggaggacttgattggagagcgcaagcaaga |
39152111 |
T |
 |
| Q |
227 |
act |
229 |
Q |
| |
|
||| |
|
|
| T |
39152112 |
act |
39152114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 39488148 - 39488062
Alignment:
| Q |
127 |
agaaaatgcaggggaagattgaagagattgtcgaggatttagtcgcgaaggaagtagagctatgtttgatggaggacttgattggag |
213 |
Q |
| |
|
|||||||||||||||| |||||||| |||| | ||||| || || ||||||| | |||||| ||||||||||||||||||||||| |
|
|
| T |
39488148 |
agaaaatgcaggggaaaattgaagaatgtgtcaaagattttgtagcaaaggaaggacagctatatttgatggaggacttgattggag |
39488062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 229
Target Start/End: Complemental strand, 39422447 - 39422345
Alignment:
| Q |
127 |
agaaaatgcaggggaagattgaagagattgtcgaggatttagtcgcgaaggaagtagagctatgtttgatggaggacttgattggagagcgtaggcaaga |
226 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||| || || || |||||| | |||| | ||||||||| |||||||||||||||| | |||||| |
|
|
| T |
39422447 |
agaaaatgcaggggaaaattgaagaatgtgtcgaggaattcgtagcaaaggaatcacagctctctttgatggaaaacttgattggagagcgcaagcaaga |
39422348 |
T |
 |
| Q |
227 |
act |
229 |
Q |
| |
|
||| |
|
|
| T |
39422347 |
act |
39422345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 127 - 216
Target Start/End: Original strand, 39136395 - 39136484
Alignment:
| Q |
127 |
agaaaatgcaggggaagattgaagagattgtcgaggatttagtcgcgaaggaagtagagctatgtttgatggaggacttgattggagagc |
216 |
Q |
| |
|
||||||||||||| || ||||| || |||| ||||||| || || ||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
39136395 |
agaaaatgcagggaaaaattgacgaatgtgtcaaggattttgtagcaaaggaagggcagctcggtttgatggaggacttgattggagagc |
39136484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 229
Target Start/End: Complemental strand, 39495444 - 39495399
Alignment:
| Q |
184 |
agctatgtttgatggaggacttgattggagagcgtaggcaagaact |
229 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||| | ||||||||| |
|
|
| T |
39495444 |
agctctgtttgatggatgacttgattggagagcgcaagcaagaact |
39495399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University