View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20225_high_6 (Length: 288)

Name: NF20225_high_6
Description: NF20225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20225_high_6
NF20225_high_6
[»] chr2 (1 HSPs)
chr2 (1-137)||(7336405-7336541)


Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 7336405 - 7336541
Alignment:
1 tgagctaacaaattagctctaatagttttcaccaacatatcatccaactgagaaactttgatagtgtccaggatattcaactgaccaactacattcccca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7336405 tgagctaacaaattagctctaatagttttcaccaacatatcatccaactgagaaactttgatagtgtccaggatattcaactgaccaactacattcccca 7336504  T
101 agacaacatccaactgagcaactatattcatcaacaa 137  Q
    |||||||||||||||||||||||||||||||||||||    
7336505 agacaacatccaactgagcaactatattcatcaacaa 7336541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University