View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20225_high_9 (Length: 237)
Name: NF20225_high_9
Description: NF20225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20225_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 1609131 - 1609353
Alignment:
| Q |
1 |
gcaaaacattttcaaaaaggatattaaaactgaagctaatgagagatccattcaatagtaattggtttggaatttcaagacttgaaaagatattaaatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1609131 |
gcaaaacattttcaaaaaggatattaaaactgaagctaatgagagatccattcaatagtaattggtttggaatttcaagacttaaaaagatattaaatta |
1609230 |
T |
|
| Q |
101 |
gtatgcttttggcctttaggatattctttagt--gtttaatcttttattgaaggtcacgttggtgctttagtgacaaactgataagcaatactttttaac |
198 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1609231 |
gtatgcttttgacctttaggatattctttagtgcgtttaatcttttattgaaggtcatgttggtgctttagtgacaaactgataagcaatactttttaac |
1609330 |
T |
|
| Q |
199 |
tcggaaattgtaagttttcttag |
221 |
Q |
| |
|
|| ||||||||||||||||||| |
|
|
| T |
1609331 |
tcataaattgtaagttttcttag |
1609353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University