View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20225_low_7 (Length: 320)
Name: NF20225_low_7
Description: NF20225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20225_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 18 - 310
Target Start/End: Original strand, 26973207 - 26973499
Alignment:
| Q |
18 |
agaaacaccctttggaagatacttttgaatcatcatatcttgatctttgttgttttcccaatgctcaagaagaatggctctaatatgaccatgaagtcct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26973207 |
agaaacaccctttggaagatacttttgaatcatcatatcttgatctttgttgttttcccaatgctcaagaagaatggctctaatatgaccatgaagtcct |
26973306 |
T |
|
| Q |
118 |
cctgcaaagaaagctaaaatcggacgtttagatgctgacggtccaccgagaaaaccgttgattgaacctgtttggagattgatttcagggaatgaaacat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26973307 |
cctgcaaagaaagctaaaatcggacgtttagatgctgacagtccaccgagaaaaccgttgattgaacctgtttggagattgatttcagggaatgaaacat |
26973406 |
T |
|
| Q |
218 |
cttttgcagggttgaatctttccgaggtgttggcattgcatagcacgcggatggagttcttgtgtaggtatggtacggagaatgaagtctctg |
310 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26973407 |
cttttgcagggttgaatctttctgaggtgttggcattgcatagcacgcggatggagttcttgtgtaggtatggtacggagaatgaagtctctg |
26973499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University