View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20225_low_8 (Length: 288)
Name: NF20225_low_8
Description: NF20225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20225_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 7336405 - 7336541
Alignment:
| Q |
1 |
tgagctaacaaattagctctaatagttttcaccaacatatcatccaactgagaaactttgatagtgtccaggatattcaactgaccaactacattcccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7336405 |
tgagctaacaaattagctctaatagttttcaccaacatatcatccaactgagaaactttgatagtgtccaggatattcaactgaccaactacattcccca |
7336504 |
T |
 |
| Q |
101 |
agacaacatccaactgagcaactatattcatcaacaa |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7336505 |
agacaacatccaactgagcaactatattcatcaacaa |
7336541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University