View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20226_high_50 (Length: 237)
Name: NF20226_high_50
Description: NF20226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20226_high_50 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 17 - 222
Target Start/End: Original strand, 38949119 - 38949324
Alignment:
| Q |
17 |
tggagtttggctataagataagtaaattatgactaaaaaatttctcactcgatgtttaaatttaagtttttccacaaaagttcattaaacacttgaacac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38949119 |
tggagtttggctataagataagtaaattatgactaaaaaatctctcactcgatgttcaaatttaagtttttccacaaaagttcattaaacacttgaacac |
38949218 |
T |
|
| Q |
117 |
aatcattttgataaataatatgaatatgcggaatagagttgaaggaactaaatagtagttgtctagttgaaatgttgaatgatgtagtttggttggaggt |
216 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38949219 |
aatcactttgataaataatatgaatatgcggaatagagttgaaggaactaaatagtagttgtctagttgaaatgttgaatgatgtagtttggttggaggt |
38949318 |
T |
|
| Q |
217 |
gatttt |
222 |
Q |
| |
|
|||||| |
|
|
| T |
38949319 |
gatttt |
38949324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University