View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20226_low_31 (Length: 297)
Name: NF20226_low_31
Description: NF20226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20226_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-141; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 28 - 280
Target Start/End: Original strand, 3580469 - 3580721
Alignment:
| Q |
28 |
tacttttaagatggtaactgctagaggcctgacttgtagggaaaatttaacgagtgccacagtttgcatcccctattttactctcaaattaccactgttt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3580469 |
tacttttaagatggtaactgctagaggcctgacttgtagggaaaatttaacgagtgccacagtttgcatcccctattttactctcaaattaccactgttt |
3580568 |
T |
 |
| Q |
128 |
ggaaggacactttgagaaggcaccactcaaaattgcatatattccatctaaatgttatgtcaattttataatgcatgaataagtattgaatcatcataaa |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3580569 |
ggaaggacactttgagaaggcaccactcaaaattgcatatattccatctaaatgttatgtcaattttataatgcatgaataagtattgaatcatcataaa |
3580668 |
T |
 |
| Q |
228 |
tctgtcaaatacactattagaaatgtgctactgataacattatgggacaaatt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3580669 |
tctgtcaaatacactattagaaatgtgctactgataacattatgggacaaatt |
3580721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 120
Target Start/End: Original strand, 3572036 - 3572126
Alignment:
| Q |
28 |
tacttttaagatggtaactgctagaggcctgacttgtagggaaaatttaacgagtgccacagtttgcatcccctattttactctcaaattacc |
120 |
Q |
| |
|
|||||| |||||||||||||| |||||| |||||||||||||| ||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
3572036 |
tactttgaagatggtaactgc--gaggcccaacttgtagggaaaacttaacgagtgccacaatttgcatctcctattttactctcaaattacc |
3572126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 28 - 88
Target Start/End: Original strand, 3594414 - 3594474
Alignment:
| Q |
28 |
tacttttaagatggtaactgctagaggcctgacttgtagggaaaatttaacgagtgccaca |
88 |
Q |
| |
|
|||||| ||| |||||||||||||||| | |||||||||||||| |||| |||||||||| |
|
|
| T |
3594414 |
tactttgaaggtggtaactgctagaggtccaacttgtagggaaaacttaatgagtgccaca |
3594474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University