View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20226_low_36 (Length: 277)
Name: NF20226_low_36
Description: NF20226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20226_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 263
Target Start/End: Original strand, 39179914 - 39180159
Alignment:
| Q |
17 |
gaacgtggtaaa-ggatagccagagttttgcaccgcctcaaagttaaggttaagtatattgcaccattctaacttccattatcatgtgatgtgaatcatc |
115 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39179914 |
gaacgtggtaaaaggatagccagagttttgcaccgcctcaaatttaaggttaagtatattgcaccattctaacttccattatcatgtgatgtgaatcatc |
39180013 |
T |
 |
| Q |
116 |
ctttcaatatcaaaatgggataacgaagagagtgacttggctcataaaaagaatttgaaactatctatgtgcgaaacnnnnnnnnctatgtaggactata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39180014 |
ctttcaatatcaaaatgggataacgaagagagtgacttggctcataaaaagaatttgaaactatctatgtgcgaaa--aaaaaaactatgtaggactata |
39180111 |
T |
 |
| Q |
216 |
tgttcatgacaaataaaccccactcttttctttttaacataaacgaaa |
263 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39180112 |
tgttcatgacaaataaaccccaatcttttctttttaacataaacgaaa |
39180159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University