View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20226_low_38 (Length: 271)
Name: NF20226_low_38
Description: NF20226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20226_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 41852822 - 41852554
Alignment:
| Q |
1 |
cataaaagagaacagactgatcattgcacatcaaaatt----ggatatctcattccaatcaatgataaattacacaaaatacagaattttatttacaaac |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41852822 |
cataaaagagaacagactgatcattgcacatcaaatttttttgaatatctcattccaatcaatgataaattacacaaaatacagaattttatttacaaac |
41852723 |
T |
 |
| Q |
97 |
aaaacaatcgagaggatggcaaaactgtcggtgatttttaagacaaatatagaaaaccacagccaaaatttggaggcacatctgagtcaatggaacaaat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41852722 |
aaaacaatcgagaggatggcaaaactgtcggtgatttttaagacaaatatagaaaatcacagccaaaatttggaggcacatctgagtcaatggaacaaat |
41852623 |
T |
 |
| Q |
197 |
tacaataacactggcaatagtaagagcaatgagtccaaatatcagaccttcatcccaggtttcttctct |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41852622 |
tacaataacactggcaatagtaagagcaatgagtccaaatatcagaccttcatcccaggtttcttctct |
41852554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University