View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20226_low_40 (Length: 268)
Name: NF20226_low_40
Description: NF20226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20226_low_40 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 29838465 - 29838207
Alignment:
| Q |
1 |
acataccatctgatactctctgctgatgaccgtcactggatgatcttggaagcagcagcaaattagcctttgacagtaatagcattgacatcaaatgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29838465 |
acataccatctgatactctctgctgatgaccgtcactggatgatcttggaagcagcagcaaattagcctttgacagtaatagcattgacatcaaatgcaa |
29838366 |
T |
|
| Q |
101 |
aaccgacaacacctcataccaagcattagacatggttgtttcctgtaaagagcgcacaaaagtaaccggaacaaattgatcagcattcttctctatagga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29838365 |
aaccgacaacacctcataccaagcattagacatggttgtttcctgtaaagagcgcacaaaagtaaccggaacaaattgatcagcattcttctctatagga |
29838266 |
T |
|
| Q |
201 |
agtaaattaaactcaaaaatatgtatgaattttagaaggtacctctttttcatattctt |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29838265 |
agtaaattaaactcaaaaatatgtatgaattttagaaggtacctctttttcatcttctt |
29838207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 4 - 145
Target Start/End: Original strand, 34628143 - 34628284
Alignment:
| Q |
4 |
taccatctgatactctctgctgatgaccgtcactggatgatcttggaagcagcagcaaattagcctttgacagtaatagcattgacatcaaatgcaaaac |
103 |
Q |
| |
|
|||| ||||||||| | |||||||||| || |||||| ||||||||| || | |||||||||| ||| || ||||| ||| |||||| ||||| || |
|
|
| T |
34628143 |
taccttctgatacttttggctgatgaccatcggtggatgttcttggaagaagtaataaattagcctgtgatagcaatagtgttgccatcaagtgcaagac |
34628242 |
T |
|
| Q |
104 |
cgacaacacctcataccaagcattagacatggttgtttcctg |
145 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
34628243 |
tgacaacacttcataccaagcattagacatggctgtttcctg |
34628284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University