View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20226_low_42 (Length: 263)
Name: NF20226_low_42
Description: NF20226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20226_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 19 - 250
Target Start/End: Complemental strand, 9330143 - 9329912
Alignment:
| Q |
19 |
atgttgcatactagattcttggtagtttggtcacctaccatgctcatatataaaagtatgaccagaatattagctagcttttacattttgatggttttgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9330143 |
atgttgcatactagattcttggtagtttggtcacctaccatgctcatatataaaagtatgaccagaatattagctagcttttacattttgatggttttgc |
9330044 |
T |
 |
| Q |
119 |
tgattgaatttcctttacttttcatttatcatgacaccaaaacataacaaagaacctgcataaaatatcatttaatgaacatatcttttctgcattcttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9330043 |
tgattgaatttcctttacttttcatttatcatgacaccaaaacataacaaagaacctgcataaaatatcatttaatgaacatatcttttctgcattcttc |
9329944 |
T |
 |
| Q |
219 |
atccaccattgttttagtaatattttgcacct |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9329943 |
atccaccattgttttagtaatattttgcacct |
9329912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 121 - 250
Target Start/End: Complemental strand, 9357671 - 9357542
Alignment:
| Q |
121 |
attgaatttcctttacttttcatttatcatgacaccaaaacataacaaagaacctgcataaaatatcatttaatgaa-catatcttttctgcattcttca |
219 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||| |||||||| || |||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
9357671 |
attgaatttcctttacctttcatttatcatggttccaaaacataaaaaagaaccaagatgaaatatcatt-aatgaaacatatcttttctgcattcttcg |
9357573 |
T |
 |
| Q |
220 |
tccaccattgttttagtaatattttgcacct |
250 |
Q |
| |
|
|||| || |||||||| ||||||||||||| |
|
|
| T |
9357572 |
tccaacacggttttagtgatattttgcacct |
9357542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 179 - 250
Target Start/End: Complemental strand, 9350207 - 9350136
Alignment:
| Q |
179 |
taaaatatcatttaatgaacatatcttttctgcattcttcatccaccattgttttagtaatattttgcacct |
250 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||| ||| |||||||| ||||||||||||| |
|
|
| T |
9350207 |
taaaatatcatttaatggacatattttttctgcattcttcatccaacatagttttagtgatattttgcacct |
9350136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University