View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20226_low_43 (Length: 262)
Name: NF20226_low_43
Description: NF20226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20226_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 252
Target Start/End: Complemental strand, 54013015 - 54012782
Alignment:
| Q |
19 |
agaaaatcattagaaatgagcatgcatttatctatatagtggtccaaccaatgtgtattgattcatgtctttttctatgctatgcagatatcacaatctt |
118 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54013015 |
agaaaatcattagaaatgagcctgcatttatctatatagtggtccaaccaatgtgtattgattcatgtctttttctatgctatgcagatatcacaatctt |
54012916 |
T |
 |
| Q |
119 |
caccacactgaaaaggacaccaatttctgcctctttatgcctctctttgacgcattaggcaatactcttaacaaaaattcatggacattacacgaaacat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54012915 |
caccacactgaaaaggacaccaatttctgcctctttatgcctctctttgacgcattaggcaatactcttaacaaaaattcatggacattacacgaaacat |
54012816 |
T |
 |
| Q |
219 |
taagttcaggttcaggtaattaacttgtcctatg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
54012815 |
taagttcaggttcaggtaattaacttgtcctatg |
54012782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University