View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20226_low_51 (Length: 241)
Name: NF20226_low_51
Description: NF20226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20226_low_51 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 4244551 - 4244784
Alignment:
| Q |
1 |
tgagttttaaaaatcttatcaactttaaatgttgccaagaatcaacgtcccataaatacaattcagatggtaaatcaatgttaacgaaaatcgatgtttt |
100 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4244551 |
tgagttttaaacaccttatcaactttaaatgttgccaagaatcaacgtcccataagtacaatttagatggtaaatcaatgttaacaaaaatcgatgtttt |
4244650 |
T |
|
| Q |
101 |
gtaaatacattcatttattggcatttaatttgtatgagtttcaccgttagactctttagaaca----------aaaataaaataaatcaaactagagaaa |
190 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
4244651 |
gtaaatacatttatttattggcatttaatttgtatgagtttcaccgttagactctttaaaacaaaaataaaataaaataaaataaatcaaactagagaaa |
4244750 |
T |
|
| Q |
191 |
tgtatgcatatccaagtgtaagaatatatattct |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4244751 |
tgtatgcatatccaagtgtaagaatatatattct |
4244784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 125 - 167
Target Start/End: Complemental strand, 31130938 - 31130896
Alignment:
| Q |
125 |
ttaatttgtatgagtttcaccgttagactctttagaacaaaaa |
167 |
Q |
| |
|
||||| |||||||||||||||| || ||||||||||||||||| |
|
|
| T |
31130938 |
ttaatgtgtatgagtttcaccgctaaactctttagaacaaaaa |
31130896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 172
Target Start/End: Complemental strand, 12526932 - 12526895
Alignment:
| Q |
135 |
tgagtttcaccgttagactctttagaacaaaaataaaa |
172 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
12526932 |
tgagtttcgccgttagactctttagaacaaaaaaaaaa |
12526895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University