View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20226_low_56 (Length: 233)
Name: NF20226_low_56
Description: NF20226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20226_low_56 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 18 - 148
Target Start/End: Original strand, 41425447 - 41425573
Alignment:
| Q |
18 |
cacaatggatgcaatatctaacctttcaatatatacttctcactcttactcttatattaagtcgatcgttagagtttttacatgtatcctaacttgtatc |
117 |
Q |
| |
|
||||| |||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41425447 |
cacaagggatgcaacatctaacctttcaata----cttctcactcttactcttatattaagtcgatcgttagagtttttacatgtatcctaacttgtatc |
41425542 |
T |
 |
| Q |
118 |
tctagggtcgctacttggcaaaggactctta |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41425543 |
tctagggtcgctacttggcaaaggactctta |
41425573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 145 - 188
Target Start/End: Original strand, 41427145 - 41427188
Alignment:
| Q |
145 |
cttatattgttccttttaattttattatatgtcaagtttttcta |
188 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41427145 |
cttatactattccttttaattttattatatgtcaagtttttcta |
41427188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University