View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20226_low_59 (Length: 214)
Name: NF20226_low_59
Description: NF20226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20226_low_59 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 99 - 214
Target Start/End: Complemental strand, 42454904 - 42454789
Alignment:
| Q |
99 |
ctttaagaaagtataaattctcataattttattt-gaagtcaatttaaannnnnnnnaacggcaaagtgaattttattaaaacaaagagagagttgaata |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| | |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42454904 |
ctttaagaaagtataaattctcataattttattttgaagtcaatttatattttttt-aacggcaaagtgaattatattaaaacaaagagagagttgaata |
42454806 |
T |
 |
| Q |
198 |
accactaataatacaaa |
214 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
42454805 |
accagtaataatacaaa |
42454789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University