View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20226_low_61 (Length: 203)
Name: NF20226_low_61
Description: NF20226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20226_low_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 20 - 189
Target Start/End: Original strand, 36743651 - 36743820
Alignment:
| Q |
20 |
gattccattacatttctttgcaactcatgggtttacaatgctaaacaatatcgcaaggaccgaattttctttgccaataaggtaccaaacaactttaact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36743651 |
gattccattacatttctttgcaactcatgggtttacaatgctaaacaatatcgcaaggaccgaattttctttgccaataaggtaccaaacaactttaact |
36743750 |
T |
 |
| Q |
120 |
ttactatttttaacttcggtatcaaaataacttttaagctcnnnnnnngttgggccaaacacaccctatg |
189 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
36743751 |
ttattatttttaacttcggtatcaaaataacttttaagctcaaaaaaagtcgggccaaacacaccctatg |
36743820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University