View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20227_low_10 (Length: 251)
Name: NF20227_low_10
Description: NF20227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20227_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 14 - 209
Target Start/End: Complemental strand, 4131747 - 4131552
Alignment:
| Q |
14 |
gtgagaagaagggtgttgcaaagagaaaggcattgacagaagcaaccaatcttcaacagtccaatgtcatcgagattacagggaaatggcaatgcccaca |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4131747 |
gtgaaaagaagggtgttgcaaagagaaaggcattgacagaagcaaccaatcttcaacagtccaatgtcatcgagattacagggaaatggcattgcccaca |
4131648 |
T |
|
| Q |
114 |
gaaacgtaagcctgatcgtgggcctgctttgaagcaacttaggcttgagcgatgggttcacaaggttggaaatatctctcctcattgacatagttg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4131647 |
gaaacgtaagcctgatcgtgggcctgctttgaagcaacttaggcttgagcgatgggttcaaaaggttggaaatatctctcctcattgacatagttg |
4131552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 25 - 203
Target Start/End: Complemental strand, 4108510 - 4108332
Alignment:
| Q |
25 |
ggtgttgcaaagagaaaggcattgacagaagcaaccaatcttcaacagtccaatgtcatcgagattacagggaaatggcaatgcccacagaaacgtaagc |
124 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||| |||||||||| |||||||| |||||||||||||||||||||| |||||| |||||||| | |
|
|
| T |
4108510 |
ggtgttgcaaaaagaaaggcactgacagaagcaaccaattttcaacagtcaaatgtcatggagattacagggaaatggcaattcccacataaacgtaaac |
4108411 |
T |
|
| Q |
125 |
ctgatcgtgggcctgctttgaagcaacttaggcttgagcgatgggttcacaaggttggaaatatctctcctcattgaca |
203 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||||| ||||||||||| ||||| |
|
|
| T |
4108410 |
ctgactgtgggcctgctttgaagcaacttaggcttgagagatgggttcataaggttggaaagatctctcctcagtgaca |
4108332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University