View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20227_low_11 (Length: 242)
Name: NF20227_low_11
Description: NF20227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20227_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 10 - 226
Target Start/End: Original strand, 54786589 - 54786804
Alignment:
| Q |
10 |
agaacctgtgttgcacagggttggaggtggaaggtatacttgggatccaaaaattaacttcacaaattgggcaagtaatgagcacttttatcagggtgat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54786589 |
agaacctgtgttgcacagggttggaggtggaaggtatacttgggatccaaaaattaacttcacaaattgggcaagtaatgagcacttttaccagggtgat |
54786688 |
T |
 |
| Q |
110 |
tggctatgtaagttcgttccttcctgacacatgttgattaatatcattgcaaataatttatttattattaactgaagtgaattctcttttttgtaaatag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54786689 |
tggctatgtaagttcgttccttcctgacacatgttgattaatatcattgcaaat-atttatttattattaactgaagtgaattctcttttttgtaaatag |
54786787 |
T |
 |
| Q |
210 |
attttggttttgataag |
226 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
54786788 |
attttggttttgataag |
54786804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University