View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20228_high_17 (Length: 320)
Name: NF20228_high_17
Description: NF20228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20228_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 157 - 301
Target Start/End: Original strand, 28280797 - 28280941
Alignment:
| Q |
157 |
aaaccctatattttcctcactcactgtagacttagaggttcctgtatatttttctaggcgtgcagtggaaatttcacaaagtgacaaaagcaatcaaagg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28280797 |
aaaccctatattttcctcactcactgtagacttagaggttcctgtatatttttctaggcgtgctgtggaaatttcacaaagtgacaaaagcaatcaaagg |
28280896 |
T |
 |
| Q |
257 |
tttttaaggaaatatggtgttggaattcatagccggagaacaatg |
301 |
Q |
| |
|
||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28280897 |
tttctaaggaaatatggtggtggaattcatagccggagaacaatg |
28280941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University