View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20228_high_23 (Length: 237)
Name: NF20228_high_23
Description: NF20228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20228_high_23 |
 |  |
|
| [»] chr4 (5 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 150 - 237
Target Start/End: Complemental strand, 1601225 - 1601137
Alignment:
| Q |
150 |
ttgcttctgctctccgtgagagaccaacattgaggtctttatc-ttttcacctatttttcattcgcaagaatatggaattttgattact |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1601225 |
ttgcttctgctctccgtgagagaccaacattgaggtctttatccttttcacctatttttcattcgcaagaatatggaattttgattact |
1601137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 146 - 192
Target Start/End: Original strand, 21833637 - 21833683
Alignment:
| Q |
146 |
ggcattgcttctgctctccgtgagagaccaacattgaggtctttatc |
192 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
21833637 |
ggcattgcttcagctctccgtgagagaccaacattgagttctttatc |
21833683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 149 - 199
Target Start/End: Complemental strand, 571059 - 571009
Alignment:
| Q |
149 |
attgcttctgctctccgtgagagaccaacattgaggtctttatcttttcac |
199 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||||||||||||| |||||| |
|
|
| T |
571059 |
attgcttctgctctacgtgtgaggccaacattgaggtctttatcctttcac |
571009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 189
Target Start/End: Original strand, 53761152 - 53761192
Alignment:
| Q |
149 |
attgcttctgctctccgtgagagaccaacattgaggtcttt |
189 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
53761152 |
attgcttctgctctccgtgaaagaccaacattgacgtcttt |
53761192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 146 - 192
Target Start/End: Original strand, 8183618 - 8183664
Alignment:
| Q |
146 |
ggcattgcttctgctctccgtgagagaccaacattgaggtctttatc |
192 |
Q |
| |
|
|||||||||||||| | | ||||||||||||||||||||||||||| |
|
|
| T |
8183618 |
ggcattgcttctgcattacttgagagaccaacattgaggtctttatc |
8183664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 19467779 - 19467822
Alignment:
| Q |
149 |
attgcttctgctctccgtgagagaccaacattgaggtctttatc |
192 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19467779 |
attgcttctgctatccgtgagagaccaacattgaggtctttatc |
19467822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 192
Target Start/End: Complemental strand, 7554908 - 7554874
Alignment:
| Q |
158 |
gctctccgtgagagaccaacattgaggtctttatc |
192 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7554908 |
gctctccatgagagaccaacattgaggtctttatc |
7554874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 46 - 192
Target Start/End: Original strand, 18314867 - 18315013
Alignment:
| Q |
46 |
tcattactacatcgacgtccaattgcttttccacttgttcaagaactgtatgtttctcaaagaggttatcttattggagttgtatcctgtaaccagtgtt |
145 |
Q |
| |
|
||||||||||||| ||| |||| |||||||||||||||||||||||||| | ||||| ||||| ||| |||| | | ||| |||||| | |
|
|
| T |
18314867 |
tcattactacatcaacgatcaatcgcttttccacttgttcaagaactgtaagcttctcgaagagacaatcatattttactgtcatcaaataaccaacgcg |
18314966 |
T |
 |
| Q |
146 |
ggcattgcttctgctctccgtgagagaccaacattgaggtctttatc |
192 |
Q |
| |
|
|| ||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18314967 |
ggtattgcttttgctctccgtgagagaccaactttgaggtctttatc |
18315013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 209
Target Start/End: Complemental strand, 21235883 - 21235823
Alignment:
| Q |
149 |
attgcttctgctctccgtgagagaccaacattgaggtctttatcttttcacctatttttca |
209 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||||||||||||| |||||| |||||||| |
|
|
| T |
21235883 |
attgcttctgctctacgtgtgaggccaacattgaggtctttatcctttcacaaatttttca |
21235823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 193
Target Start/End: Original strand, 17627314 - 17627362
Alignment:
| Q |
145 |
tggcattgcttctgctctccgtgagagaccaacattgaggtctttatct |
193 |
Q |
| |
|
||||||||||||||| |||||||||||||| | ||||||||||||||| |
|
|
| T |
17627314 |
tggcattgcttctgccatccgtgagagaccatctttgaggtctttatct |
17627362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 150 - 192
Target Start/End: Original strand, 17643284 - 17643326
Alignment:
| Q |
150 |
ttgcttctgctctccgtgagagaccaacattgaggtctttatc |
192 |
Q |
| |
|
||||||||||||| |||||||| ||||| |||||||||||||| |
|
|
| T |
17643284 |
ttgcttctgctctacgtgagaggccaacgttgaggtctttatc |
17643326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 146 - 191
Target Start/End: Original strand, 6588612 - 6588657
Alignment:
| Q |
146 |
ggcattgcttctgctctccgtgagagaccaacattgaggtctttat |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
6588612 |
ggcattgcttctgctctccgtgagagaccaaaattgacgtctttat |
6588657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 143 - 189
Target Start/End: Complemental strand, 9411856 - 9411810
Alignment:
| Q |
143 |
gttggcattgcttctgctctccgtgagagaccaacattgaggtcttt |
189 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
9411856 |
gttggcattgtttctgctctctgtgagagaccaaccttgaggtcttt |
9411810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 189
Target Start/End: Complemental strand, 28532533 - 28532490
Alignment:
| Q |
146 |
ggcattgcttctgctctccgtgagagaccaacattgaggtcttt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
28532533 |
ggcattgcttctgctctccgtgagagaccgacattgatgtcttt |
28532490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 150 - 192
Target Start/End: Original strand, 41900804 - 41900846
Alignment:
| Q |
150 |
ttgcttctgctctccgtgagagaccaacattgaggtctttatc |
192 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41900804 |
ttgcttctgctctccgccagagaccaacattgaggtctttatc |
41900846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 142 - 192
Target Start/End: Complemental strand, 32268289 - 32268239
Alignment:
| Q |
142 |
tgttggcattgcttctgctctccgtgagagaccaacattgaggtctttatc |
192 |
Q |
| |
|
|||||| |||||| ||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
32268289 |
tgttggtattgctaatgccctccgtgagagaccaacattgaggtctgtatc |
32268239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 143 - 192
Target Start/End: Original strand, 41886922 - 41886971
Alignment:
| Q |
143 |
gttggcattgcttctgctctccgtgagagaccaacattgaggtctttatc |
192 |
Q |
| |
|
||||| |||| |||||||||||| || ||||||||||||| ||||||||| |
|
|
| T |
41886922 |
gttggtattgtttctgctctccgggaaagaccaacattgaagtctttatc |
41886971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 182
Target Start/End: Original strand, 514011 - 514044
Alignment:
| Q |
149 |
attgcttctgctctccgtgagagaccaacattga |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
514011 |
attgcttctgctctccgtgagagaccaacattga |
514044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 31 - 87
Target Start/End: Original strand, 51113405 - 51113461
Alignment:
| Q |
31 |
ggttaatctctcgtgtcattactacatcgacgtccaattgcttttccacttgttcaa |
87 |
Q |
| |
|
|||||||||||| |||||||||||||| || ||||||| |||||||||||||||| |
|
|
| T |
51113405 |
ggttaatctctctagtcattactacatcaactaccaattgtttttccacttgttcaa |
51113461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 153 - 192
Target Start/End: Original strand, 51763736 - 51763775
Alignment:
| Q |
153 |
cttctgctctccgtgagagaccaacattgaggtctttatc |
192 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
51763736 |
cttctgctctccgtgaaagaccaacattgacgtctttatc |
51763775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University