View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20228_high_24 (Length: 231)
Name: NF20228_high_24
Description: NF20228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20228_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 16065755 - 16065548
Alignment:
| Q |
18 |
caatgaagcaattctttttctatatttgatgattccttagtcc-tttgatggctatacaccaatcaaattaaaaagtgtagggaagggaccacttgaatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16065755 |
caatgaagcaattctttttctatatttgatgattccttggtccctttgatggttatacaccaatcaaattaaaaagtgtagggaagggaccacttgaatt |
16065656 |
T |
|
| Q |
117 |
gaaatatcaaattattctgggtatgtttg----attggaatggaaaggaacgaaattaaatgggacaatgtctagtttttaaaatgtaactaatcaactt |
212 |
Q |
| |
|
|| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
16065655 |
ga--tatcaaattattctgggtatgtttgtttgattggaatggaaaggaacgaaattaaatgggacaatgtctagtttttaaaatgtaactaatcaattt |
16065558 |
T |
|
| Q |
213 |
catctcactc |
222 |
Q |
| |
|
||| |||||| |
|
|
| T |
16065557 |
catttcactc |
16065548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University