View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20228_low_19 (Length: 324)
Name: NF20228_low_19
Description: NF20228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20228_low_19 |
 |  |
|
| [»] scaffold0208 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0208 (Bit Score: 69; Significance: 6e-31; HSPs: 2)
Name: scaffold0208
Description:
Target: scaffold0208; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 216 - 316
Target Start/End: Complemental strand, 3579 - 3479
Alignment:
| Q |
216 |
tctaagttgatccattgaaagaggcaaaaactggattgttatttatgaacaaatgttcaatgcagctaaagcttcattccagatgttatgagatattctt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |||||||||| ||||||| |||||||||| ||||| |
|
|
| T |
3579 |
tctaagttgatccattgaaagaggcaaaaactagatccttatttatgaacaaatgttcaatgctgctaaagctttattccagcggttatgagatcttctt |
3480 |
T |
 |
| Q |
316 |
c |
316 |
Q |
| |
|
| |
|
|
| T |
3479 |
c |
3479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0208; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 58 - 124
Target Start/End: Complemental strand, 3855 - 3789
Alignment:
| Q |
58 |
ttacaaatttattcattccttaagaattggttgaattattcttgatatacacatcacgatctcaaaa |
124 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
3855 |
ttacaaatttattcatttcttaagaattcgttgaattattcttaatatacacatcatgatctcaaaa |
3789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University