View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20228_low_30 (Length: 233)
Name: NF20228_low_30
Description: NF20228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20228_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 14 - 215
Target Start/End: Complemental strand, 44695388 - 44695187
Alignment:
| Q |
14 |
aaaataccattcaatgacttcacatacatgcagagttttcagaaactatcnnnnnnnnttcatcttttttcaatcttcatttcatatggttggcatctaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44695388 |
aaaataccattcaatgacttcacatacatgcagagttttcagaaactatcaaaaaaatttcatcttttttcaatcttcatttcatatgattggcatctaa |
44695289 |
T |
|
| Q |
114 |
atatgcacttaggaaacaagtgagtatctcatagaatcatagtttatgtaggccatatccatttagaaatatgtatagaaacagtttagccctcaaaggt |
213 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44695288 |
atttgcacttaggaaacaagtgagtatctcatagaatcatagtttatgtatgccatatccgtttagaaatatgtatagaaacagtttagccgtcaaaggt |
44695189 |
T |
|
| Q |
214 |
ct |
215 |
Q |
| |
|
|| |
|
|
| T |
44695188 |
ct |
44695187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University