View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20228_low_9 (Length: 436)
Name: NF20228_low_9
Description: NF20228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20228_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 171 - 419
Target Start/End: Complemental strand, 44970535 - 44970289
Alignment:
| Q |
171 |
cagtcttcttgatagagtttccaatgtaagatgagtccatgatattacattgtctccaaaaataggaagaagtctcatgactcataatttgaacccaaag |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44970535 |
cagtcttcttgatagagtttccaatgtaagatgagtccataatattactttgtctccaaaaataggaagaagtctcatgactcataatttgaacccaaag |
44970436 |
T |
|
| Q |
271 |
cttattacggtcatgtcacatgctcgaaactattttatctaacatagaagtatatatattagcctctctagcacgcttcacattagaacacccttttatg |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44970435 |
cttattacggtcatgtcacatgctcgaaactattttatctaacatagaagtat--atattagcctctctagcacgcttcacattagaacacccttttatg |
44970338 |
T |
|
| Q |
371 |
ttttggtgtatagtaaccttatctcaatcaacaagatgaaactcgtgat |
419 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44970337 |
ttttggtgtatagtaaccttatctcaatcaacaagatgaaactcgtgat |
44970289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 32 - 109
Target Start/End: Complemental strand, 44970609 - 44970532
Alignment:
| Q |
32 |
aagttaaaacaaacttaccctaaataaacatccctgaatttgagcagagtatcatgaacccaaactataccaatcagt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
44970609 |
aagttaaaacaaacttaccctaaataaacatccctgaatttgtgcagagtatcatgaacccaaactacaccaatcagt |
44970532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University