View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2022_low_8 (Length: 230)
Name: NF2022_low_8
Description: NF2022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2022_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 16 - 212
Target Start/End: Original strand, 8438903 - 8439098
Alignment:
| Q |
16 |
atgaatgtgatgatcggacataggggcaaacccctatttattttatttctaagttttgtgcaggttgtttctatcttttacttagataatcgtttcaagc |
115 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8438903 |
atgaatgtgatgatcagacataggggcaaacccctatttattgtatttctaagttttgtgcaggttgtttctatcttt-acttagataatcgtttcaagc |
8439001 |
T |
 |
| Q |
116 |
caatgatattgtaaataagcttaaggaattcacttctttcagctgggacccaatccattttaaaataattgtaaaagatgtgttaagtggtgatttt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
8439002 |
caatgatattgtaaataagcttaaggaattcacttctttcagctgggacccaatccattttaaaataattgtaaaagatttgttcagtggtgatttt |
8439098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University