View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20233_high_5 (Length: 370)
Name: NF20233_high_5
Description: NF20233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20233_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 360
Target Start/End: Original strand, 55689506 - 55689861
Alignment:
| Q |
1 |
acttgtgacatgaatgagtctgtgatcagcagtggctgtcacatatttgtaagatattgatagcctgttgaaaatttgccnnnnnnnaggaatgactgag |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
55689506 |
acttgtgacatgaatgagtctg--atcagcagtggctgtcacatatttgtaagatattgatagcctgttgaaaatttgcctttttttaggaatgactgag |
55689603 |
T |
|
| Q |
101 |
gggttatgaacttgtgatataaatgagtctgtaatcactaatcatcagtggctgtacctgccgatgtttttctgtttgagatggattagaagttgaaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
55689604 |
gggttatgaacttgtgatataaatgagtctgtaatcactaatcagcagtggctgtacctgccgatgtttttctgtttgagatggattagaagttgaa--c |
55689701 |
T |
|
| Q |
201 |
gatggttcattgctttgtattgtgtgttacttgattgatacctgctttttatgattaacagggaagtccttagggtccatggaaagggtgaaatcatagt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55689702 |
gatggttcattgctttgtattgtgtgttacttgattggtacctgctttttatgattaacagggaagtccttagggtccatggaaagggtgaaatcatagt |
55689801 |
T |
|
| Q |
301 |
actctggctcggtgaaatttcgacacattgagtttattttgctctttgcaaacgtttctt |
360 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55689802 |
actctgcctcggtgaaatttcaacacattgagtttattttgctctttgcaaacgtttctt |
55689861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University