View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20233_high_7 (Length: 348)
Name: NF20233_high_7
Description: NF20233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20233_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 79 - 310
Target Start/End: Complemental strand, 51657252 - 51657019
Alignment:
| Q |
79 |
taatggagctggggagagggaataagagctattttagttacatatatgtttgatttaaaaggaggggagggattttagttacatat--gtttggttcaaa |
176 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51657252 |
taatggagctggggagggggaataagagctattttagttacatatatgtttgatttaaaaggaggggagggattttagttacatatatgtttggttcaaa |
51657153 |
T |
 |
| Q |
177 |
agttaaggggatagattttgaaataatttccaagtctcatgatgcatatatacctgtgaggttaaaagaagttttgacacctatttctttacaaatttct |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51657152 |
agttaaggggatagattttgaaataatttccaagtctcatgatgcatatatacctgtgaggttaaaagaagttttgacacctatttctttacaaatttct |
51657053 |
T |
 |
| Q |
277 |
accagttttaccgggacaaataaacaatagcacc |
310 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
51657052 |
accaattttaccgggacaaataaacaatagcacc |
51657019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 51657404 - 51657323
Alignment:
| Q |
1 |
tatagggcaaactgcaaaagagagcaaggtatacatgtgtaagtagttattacatggttagctaattaatcagttatataat |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51657404 |
tatagggcaaactgcaaaagagagcaaggtatacatgtgtaagtagttattacatggttagctaattaatcagttatataat |
51657323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University