View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20233_low_12 (Length: 231)
Name: NF20233_low_12
Description: NF20233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20233_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 41043454 - 41043673
Alignment:
| Q |
1 |
aagattgctaggctccttatatttgcttggtggatctggaggcgctgatggaaataggggtccttgtttcacagatttcttgcgcgaaaaggttcgagac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41043454 |
aagattgctaggctccttatatttgcttggtggatctggaggcgttgatggaaataggggtccttgtttcacagatttcttgcgcgaaaaggttcgagac |
41043553 |
T |
 |
| Q |
101 |
agctgcttttgcagtccctctgaaccttttttagccaaatctcttgcttgtttccatttttcgcgagcctgtaccgtttctcttacgtgttttgctgcag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41043554 |
agctgcttttgcagtccctctgaaccttttttagccaaatctcttgcttgtttccatttttcgcgagcctgtaccgtttctcttacgtgttttgctgcag |
41043653 |
T |
 |
| Q |
201 |
cttctcttgattttgccttt |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
41043654 |
cttctcttgattttgccttt |
41043673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 213
Target Start/End: Complemental strand, 28086769 - 28086715
Alignment:
| Q |
159 |
tttcgcgagcctgtaccgtttctcttacgtgttttgctgcagcttctcttgattt |
213 |
Q |
| |
|
|||| ||||| ||||| |||||||| || ||| |||||||||||||||||||||| |
|
|
| T |
28086769 |
tttctcgagcttgtacagtttctctcacctgtcttgctgcagcttctcttgattt |
28086715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University