View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20233_low_13 (Length: 220)
Name: NF20233_low_13
Description: NF20233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20233_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 14 - 165
Target Start/End: Complemental strand, 17641149 - 17640998
Alignment:
| Q |
14 |
aatattgggactggaaaatacttgggcttgccttccatggtcggaggaagtaagaaagctatctttattcacagcaaagatagagtttggaggaaatgtc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17641149 |
aatattgggactggaaaatacttgggcttgccttccatggtcggaggaagtaagaaagctatctttattcacagcaaagatagagtttggaggaaatgtc |
17641050 |
T |
 |
| Q |
114 |
aatcttggagtgctaaatctttatctcgggctggcaaagaggtattaatcaa |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17641049 |
aatcttggagtgctaaatctttatctcgggctggcaaagaggtattaatcaa |
17640998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 88 - 138
Target Start/End: Original strand, 16425992 - 16426042
Alignment:
| Q |
88 |
caaagatagagtttggaggaaatgtcaatcttggagtgctaaatctttatc |
138 |
Q |
| |
|
|||||||||| | ||||||||||| |||||||||||||| |||||| |||| |
|
|
| T |
16425992 |
caaagatagaatatggaggaaatgccaatcttggagtgcaaaatctctatc |
16426042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 98 - 178
Target Start/End: Original strand, 26659259 - 26659339
Alignment:
| Q |
98 |
gtttggaggaaatgtcaatcttggagtgctaaatctttatctcgggctggcaaagaggtattaatcaagtctgtggctcaa |
178 |
Q |
| |
|
||||||| |||||||||||| |||||||| ||||| | || ||||| || ||||||||| |||| || ||||||| |||| |
|
|
| T |
26659259 |
gtttggaagaaatgtcaatcgtggagtgccaaatcgctttcccgggccggtaaagaggtactaattaaatctgtggttcaa |
26659339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University