View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20233_low_2 (Length: 418)
Name: NF20233_low_2
Description: NF20233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20233_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 18 - 404
Target Start/End: Complemental strand, 24316272 - 24315880
Alignment:
| Q |
18 |
tttccaaagatgtcgctaatacccatcaacaaccgtcaaggcaacagttccaacaca------aacctttgggatacaaatcccctatctctatgggatc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24316272 |
tttccaaagatgtcgctaatacccatcaacaaccgtcaaggcaacagttccaacacatctcttaacctttgggatccaaatcccctatctctatgggatc |
24316173 |
T |
 |
| Q |
112 |
cattcatggatttacacttcccactcccttcacccatcaccaatttcttccatgaattcagcttcggatcatccctaaacacccgtatggattggagaga |
211 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24316172 |
cattcatggatttccacttcccactcccttcacccatcaccaatttcttccctgatttcagcttcggatcatccctaaacacccgtatggattggagaga |
24316073 |
T |
 |
| Q |
212 |
gacaccgagagctcatatttggaaggtggtgcttcctggtttcacaaacgaagatgtgttgattgagcttcaagatgagagaatgcttcaggttagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24316072 |
gacaccgagagctcatatttggaaggtggtgcttcctggtttcacaaacgaagatgtgtttgttgagcttcaagatgagagaatgcttcaggttagtgtt |
24315973 |
T |
 |
| Q |
312 |
gagagtggtaatttcatgagtaggtttaagattcctgatgatggtaaccttcaagagcttaaagcgaatatggttaatggtgttcttgttgtc |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24315972 |
gagagtggtaatttcatgagtaggtttaagattcctgatgatggtaaccttcaagagcttaaagcgaatatggttaatggtgttcttgttgtc |
24315880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University