View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20234_high_2 (Length: 211)
Name: NF20234_high_2
Description: NF20234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20234_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 4e-77; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 33289790 - 33289955
Alignment:
| Q |
1 |
ttttgcaacccatgaatagtttgagagctttttcaggattgctagtgttgtttcgtaagcaattttctcacctggagccttgcatgacatctgcgaccga |
100 |
Q |
| |
|
|||| |||||||| ||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33289790 |
tttttcaacccataaattgtttgagagctttttcaggattgttagtgttgtttcgtaagcaattttctcacccggagccttgcatgacatctgcgaccga |
33289889 |
T |
|
| Q |
101 |
catacaatctatatgagtttacttctaatctagggttttcacgatgcgatatgaattggttcttag |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33289890 |
catacaatctatatgagtttacttctaatctagggttttcacgatgcgatatgaattggttcttag |
33289955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 33180308 - 33180201
Alignment:
| Q |
1 |
ttttgcaacccatgaatagtttgagagctttttcaggattgctagtgttgtttcgtaagcaattttctcacctggagccttgcatgacatctgcgaccga |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||| ||||||||||||||||| ||| ||||||| |||||||||||||||||||| ||||||| ||| |
|
|
| T |
33180308 |
ttttgcaacccatgaatagtttgacagcttgttcaagattgctagtgttgttttgtatgcaatttcctcacctggagccttgcatgccatctgccaccat |
33180209 |
T |
|
| Q |
101 |
catacaat |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
33180208 |
catacaat |
33180201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 33139068 - 33138975
Alignment:
| Q |
1 |
ttttgcaacccatgaatagtttgagagctttttcaggattgctagtgttgtttcgtaagcaattttctcacctggagccttgcatgacatctgc |
94 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||||| ||| || |||| ||||||||| || ||||||||||||||| |
|
|
| T |
33139068 |
ttttgcaacccatgaatagtttgacagcttttttaggattgctagtgttgttttgtatgctatttcctcacctggtgctttgcatgacatctgc |
33138975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 33157493 - 33157402
Alignment:
| Q |
1 |
ttttgcaacccatgaatagtttgagagctttttcaggattgctagtgttgtttcgtaagcaattttctcacctggagccttgcatgacatct |
92 |
Q |
| |
|
||||||||||||||| |||||||| ||||| ||||||||||||||||||||| ||| ||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
33157493 |
ttttgcaacccatgagtagtttgacagcttgttcaggattgctagtgttgttctgtatgcaatttcctcacctggggccttgcatgccatct |
33157402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University