View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20234_low_7 (Length: 250)
Name: NF20234_low_7
Description: NF20234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20234_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 6856229 - 6856136
Alignment:
| Q |
1 |
tccattctgtttgtaaaccaagtcatatggtatattcagaaaccatattccaaaaccaagttcgattacatataaagccacgtactagacatag |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6856229 |
tccattctgtttgtaaaccaagtcatatggtatattcagaaaccatattccaaaaccaagttccattacatataaagccacgtactagacatag |
6856136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 141 - 244
Target Start/End: Complemental strand, 6856089 - 6855986
Alignment:
| Q |
141 |
agacaattttatttgtgtggctattgataaattctcacctaaatccatagattcttttctttattgttatatctatctatatctatgtacttactctgtg |
240 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| | ||||||||||||||||||||| ||||| || |
|
|
| T |
6856089 |
agacaatttcatttgtgtggctattgataaattctcaactaaatccatagattcttttcttttttgccacatctatctatatctatgtactcactctatg |
6855990 |
T |
|
| Q |
241 |
ctcc |
244 |
Q |
| |
|
|||| |
|
|
| T |
6855989 |
ctcc |
6855986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University