View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20235_high_12 (Length: 384)
Name: NF20235_high_12
Description: NF20235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20235_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-100; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 20 - 205
Target Start/End: Original strand, 7340598 - 7340783
Alignment:
| Q |
20 |
tagtgggtatgtatggacatatgctacacgagtgagaaaatatgggtcaacagcacatgcaaacaaagaaagtgtgatgcacaaatggggtacgaatctt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7340598 |
tagtgggtatgtatggacatatgctacacgagtgagaaaatatgggtcaacagcacatgcaaacaaagaaagtgtgatgcacaaatggggtacgaatctt |
7340697 |
T |
|
| Q |
120 |
ctaccagctagcacaaacattacccgggaaaaatgattcaaagataaaatgatgatgatgattatttttactgtttttatacaaca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7340698 |
ctaccagctagcacaaacattacccgggaaaaatgattcaaagataaaatgatgatgatgattatttttactgtttttatacaaca |
7340783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 295 - 369
Target Start/End: Original strand, 7340872 - 7340946
Alignment:
| Q |
295 |
taaaaatagaccaaattgtcatgttcaactggttgaattaattatgaactgattaattcattattgtattgtaat |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7340872 |
taaaaatagaccaaattgtcatgttcaactggttgaattaattatgaactgattaattcattattgtattgtaat |
7340946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University