View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20235_high_22 (Length: 327)
Name: NF20235_high_22
Description: NF20235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20235_high_22 |
 |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0006 (Bit Score: 132; Significance: 2e-68; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 116 - 307
Target Start/End: Complemental strand, 82750 - 82557
Alignment:
| Q |
116 |
atgtggccgttgattcaggcaggtaacgtgggccttgtacaacaaactgttagaagaaacaactgtattcctaaagataaccatcacattttagtgacta |
215 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
82750 |
atgtggccattgattcaggcaggtaacgtgggcatc--acaacaaactgttagaagaaacaactgtattcctaaacataaccatcacattttattgacta |
82653 |
T |
 |
| Q |
216 |
catgggtagatatcttacaaagagatgagaaaaagggttatgaagta----tgtgtgatgtaattctccttctatctcggtaattctctagtccct |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| || |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
82652 |
catgggtagatatcttacaaagagatgagaaaaatggttatgaagtatgcgtgagtgatgtaattctccttctatctcactaattctctagtccct |
82557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University