View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20235_high_31 (Length: 284)
Name: NF20235_high_31
Description: NF20235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20235_high_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 188 - 262
Target Start/End: Complemental strand, 29856686 - 29856613
Alignment:
| Q |
188 |
gttttcaccaacataattctatgcgagggtgatgcagcaagatgaaaatgtgaagttgaaaaatgaggatgagag |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29856686 |
gttttcaccaacataattctatgcgagggtgatgcagcaagatgaaaatgtgaagttg-aaaatgaggatgagag |
29856613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 262
Target Start/End: Complemental strand, 21426105 - 21426064
Alignment:
| Q |
221 |
gcagcaagatgaaaatgtgaagttgaaaaatgaggatgagag |
262 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21426105 |
gcagcaagttgaaaatgtgaagttgaaaaatgaggatgagag |
21426064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 183 - 242
Target Start/End: Original strand, 41311444 - 41311503
Alignment:
| Q |
183 |
gataagttttcaccaacataattctatgcgagggtgatgcagcaagatgaaaatgtgaag |
242 |
Q |
| |
|
|||||||||||||| |||| |||||||| | || |||||||||||| ||||||||||||| |
|
|
| T |
41311444 |
gataagttttcaccgacatgattctatgtgtggatgatgcagcaagttgaaaatgtgaag |
41311503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University