View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20235_low_37 (Length: 274)
Name: NF20235_low_37
Description: NF20235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20235_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 16 - 257
Target Start/End: Original strand, 40751486 - 40751727
Alignment:
| Q |
16 |
atcaatgaatggaacttctttgtgatgctcaatttcgacctcatcgcgatcttgctctttctccatggaagactttaagtttgtgattaatgttgatgag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40751486 |
atcaatgaatggaacttctttgtgatgctcaatttcgacctcatcgcgatcttgctctttctccatggaagactttaagtttgtgattaatgtagatgag |
40751585 |
T |
 |
| Q |
116 |
ttatcacataaactactcaccaaatccttctttatccttccatcatcagaagaatttaaaaaaccaaaagcatttggagcaaccctcttgtaatttggaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40751586 |
ttatcacataaactactcaccaaatccttctttatccttccatcatcagaagaatttaaaaaaccaaaagcatttggagcaaccctcttgtaatttggaa |
40751685 |
T |
 |
| Q |
216 |
gtgatgagaatgcttgattcggacagattctgtagagaaatg |
257 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40751686 |
gtgatgagaatgcttgatttggacagattctgtagagaaatg |
40751727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University