View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20235_low_39 (Length: 271)
Name: NF20235_low_39
Description: NF20235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20235_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 14 - 259
Target Start/End: Original strand, 39849836 - 39850081
Alignment:
| Q |
14 |
aggaagaggtgggacgagaggagaggtgtctgattctgagtgatcggccattaaaattgagcggaggaggatagaaatgtcacatgagagattcaatcaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39849836 |
aggaagaggtgggacgagaggagaggtgtctgattctgagtgatcggccattgaaattgagcggaggagggtagaaatgtcacatgagagattcaatcaa |
39849935 |
T |
 |
| Q |
114 |
gaattatgaatttgattagagaaagagaagaagaatttcactgttcttcttcctctctctagctatctttctttctattcaactctgaacagtgattaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39849936 |
gaattatgaatttgattagagaaagagaagaagaatttcactgttcttcttcctctctctagctatctttctttctattcaactctgaacagtgattaat |
39850035 |
T |
 |
| Q |
214 |
tttcaagtttcagtcattaattaatctacactttcacacacaggtt |
259 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39850036 |
tttcaagtttcggtcattaattaatctacactttcacacacaggtt |
39850081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University