View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20235_low_40 (Length: 271)
Name: NF20235_low_40
Description: NF20235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20235_low_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 2935840 - 2935626
Alignment:
| Q |
18 |
acacaaagcatagtagttttatatttgatcacacaacacaaatacttcttacaaagccaatgaatgcaaacaacatataacaaacttttatcaagttcaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2935840 |
acacaaagcatagtagttttatatttgatcacacaacaccaatacttcttacaaagtcaata----caaacaacatataacaaacttttatcaagttcaa |
2935745 |
T |
|
| Q |
118 |
ggtaaattgtctagagaacacttgaacacacaccatatatatttatggcatcatgagagtagtaatacttgaggaacacttgtaaaatacatatctacta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2935744 |
ggtaaattgtctagagaacacttgaacacacaccatatatatttatggcatcatgagagtagtaatacttgaggaacacttgtaaaatacgtatctacta |
2935645 |
T |
|
| Q |
218 |
aaacgttattgagcaatgt |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2935644 |
aaacgttattgagcaatgt |
2935626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 18 - 96
Target Start/End: Complemental strand, 2920892 - 2920815
Alignment:
| Q |
18 |
acacaaagcatagtagttttatatttgatcacacaacacaaatacttcttacaaagccaatgaatgcaaacaacatata |
96 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| || |||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
2920892 |
acacaaagcatagtaattttatatttgatcacacaatac-aatacttcatacaaagctaatgaatgcaaacaacatata |
2920815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 271
Target Start/End: Complemental strand, 2935665 - 2935631
Alignment:
| Q |
237 |
ttgtaaaatacgtatctactaaaacgttattgagc |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2935665 |
ttgtaaaatacgtatctactaaaacgttattgagc |
2935631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 114 - 165
Target Start/End: Complemental strand, 2920812 - 2920761
Alignment:
| Q |
114 |
tcaaggtaaattgtctagagaacacttgaacacacaccatatatatttatgg |
165 |
Q |
| |
|
||||| |||| ||| | ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2920812 |
tcaagttaaaatgtttggagaacacttgaacacacaacatatatatttatgg |
2920761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University