View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20236_high_4 (Length: 354)
Name: NF20236_high_4
Description: NF20236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20236_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 33 - 299
Target Start/End: Original strand, 51265594 - 51265858
Alignment:
| Q |
33 |
aagttttgggcagtctaacttcattttccctactgcctcataagtagaaaaccatctataaaatggaattaaagcaatatcaggaaaatcaaatgtgcct |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || |
|
|
| T |
51265594 |
aagttttgggcagtctaacttcattttccctactgtctcataagtagaaaaccatctataaaatggaattaaagcaatatcaggaaaaccaaatgtgtct |
51265693 |
T |
|
| Q |
133 |
cccgctaaatatgtcttgtcaccaagaacctcttccaatgtcttcaaattttttattaactcctccttttctttctcatgttcacccacctttccagtcc |
232 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51265694 |
cccgctaaatatggcttgtcaccaagaacctcttccaatgtcttcaaattttttattaactcctccttttctttctcatgttcacccacctttccagtcc |
51265793 |
T |
|
| Q |
233 |
atatcttctttgcaacttcatgcacttgtatatatttaacaataacattcatgtcaacataatcctt |
299 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51265794 |
atatcttctttgcaacttcatgcacctg--tatatttaacaataacattgatgtcaacataatcctt |
51265858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 306 - 338
Target Start/End: Original strand, 51265921 - 51265953
Alignment:
| Q |
306 |
tatgtgtgattgaattcaagctatacacatttt |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
51265921 |
tatgtgtgattgaattcaagctatacacatttt |
51265953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 12 - 41
Target Start/End: Original strand, 51265405 - 51265434
Alignment:
| Q |
12 |
acatctctttccccatgcaataagttttgg |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
51265405 |
acatctctttccccatgcaataagttttgg |
51265434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University