View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20236_low_6 (Length: 254)
Name: NF20236_low_6
Description: NF20236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20236_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 19 - 171
Target Start/End: Original strand, 37788402 - 37788551
Alignment:
| Q |
19 |
actacacaaatcagatatttaggatccgtgcagccacaccttttagctgtgaac--acctgatatatttgtggcagagattcaaaacctgcagaattggt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37788402 |
actacacaaatcagatatttaggatccgtgcagccacaccttttagctgtgaacgtacctgatatatttgtggcagagattcaaaacctgca-----ggt |
37788496 |
T |
|
| Q |
117 |
agagacatgtactaatatcaaagccacttctccaattagtctccctatatatata |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37788497 |
agagacatgtactaatatcaaagccacttctccaattattctccctatatatata |
37788551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University